pCMV-HA-mIFITM3

Brief Description: Expressed murine IFITM3 with an N-terminal HA tag in mammalian cells.

Vector backbone: pCMV-HA

Gene ID: 1110004C05Rik

Cloning Information: 

5′ cloning site: EcoRI (not destroyed)

3′ cloning site: SalI (not destroyed)

5′ sequencing primer: GATCCGGTACTAGAGGAACTGAAAAAC

  • Faculty Lab

           Howard Hang

           Jacob Yount

  • Relevant Publication

Yount et al Nat Chem Biol. 2010 Aug;6(8):610-4. doi: 10.1038/nchembio.405. Epub 2010 Jul 4. 

* For purchase and more information on this research tool, please visit the appropriate respository linked on this page.

Price
$65.00

This item is available for license from the following stores:

View on External Site