pcDNA4/TO/FLAG-hPMR1(2H)-Tev-Bio
Brief Description: Expresses human PMR1 endonuclease with N-terminal FLAG and C-terminal biotinylation tags.
Vector backbone: pcDNA4/TO
GenBank ID: BC132813
Cloning Information:
5′ cloning site: HindIII (unknown if destroyed)
3′ cloning site: ApaI (unknown if destroyed)
5′ sequencing primer: cggcgtgccgggtgttcatgggg
3′ sequencing primer: ggcgtccctgagccgggtgctttgtg
-
Faculty Lab
-
Relevant Publication
Gu et al RNA. 2012 Jun;18(6):1186-96. doi: 10.1261/rna.031369.111. Epub 2012 Apr 27.
* For purchase and more information on this research tool, please visit the appropriate respository linked on this page.