Brief Description: Expresses human PMR1 endonuclease with N-terminal FLAG and C-terminal biotinylation tags.

Vector backbone: pcDNA4/TO

GenBank ID: BC132813

Cloning Information: 

5′ cloning site: HindIII (unknown if destroyed)

3′ cloning site: ApaI (unknown if destroyed)

5′ sequencing primer: cggcgtgccgggtgttcatgggg

3′ sequencing primer: ggcgtccctgagccgggtgctttgtg

• Faculty  Lab

  Daniel Schoenberg

• Relevant Publication

  Gu et al RNA. 2012 Jun;18(6):1186-96. doi: 10.1261/rna.031369.111. Epub 2012 Apr 27. 

* For purchase and more information on this research tool, please visit the appropriate respository linked on this page.