pcDNA4/TO/FLAG-hPMR1(2H)-Tev-Bio

Brief Description: Expresses human PMR1 endonuclease with N-terminal FLAG and C-terminal biotinylation tags.

Vector backbone: pcDNA4/TO

GenBank ID: BC132813

Cloning Information: 

5′ cloning site: HindIII (unknown if destroyed)

3′ cloning site: ApaI (unknown if destroyed)

5′ sequencing primer: cggcgtgccgggtgttcatgggg

3′ sequencing primer: ggcgtccctgagccgggtgctttgtg

* For purchase and more information on this research tool, please visit the appropriate respository linked on this page.

Price
$65.00

This item is available for license from the following stores:

View on External Site