pEGFP-hsp27 wt FL

Brief description: A human protein 

Vector backbone: pEGFP-C2

GenBank ID: BC012768

Cloning Information:

5′ cloning site: EcoR I (not destroyed)

3′ cloning site: Sal I (not destroyed)

5′ sequencing primer: GGGATCCTAGAATTCGCCCACCATGACCGAGCGCCGCGT

3′ sequencing primer: CTCGAGGTCGACCTTGGCGGCAGTCTCATC

* For purchase and more information on this research tool, please visit the appropriate respository linked on this page.  

Price
$65.00

This item is available for license from the following stores:

View on External Site